AlienTrimmer is a command line program written in Java that to quickly trim off non-confident bases and alien oligo-nucleotide sequences (e.g. adapters, primers, …) from sequencing reads. For more details, see the associated publication (Criscuolo and Brisse 2013).
Since AlienTrimmer v2.0, this GitLab repository replaces the previous ftp repository.
AlienTrimmer v2.0 (and higher) implements the same alien k-mer search algorithm as the initial release (see S1.2 here), but use slightly different trimming criteria (see below). Of note, AlienTrimmer v2.0 has simplified options, runs quite faster (especially when compiled with GraalVM), and is able to read gzipped FASTQ files.
Run AlienTrimmer without option to read the following documentation:
AlienTrimmer
Fast trimming to filter out non-confident nucleotides and alien oligo-nucleotide sequences
(adapters, primers) in both 5' and 3' read ends
Criscuolo and Brisse (2013) doi:10.1016/j.ygeno.2013.07.011
USAGE: AlienTrimmer [options]
OPTIONS:
-i <infile> [SE] FASTQ-formatted input file; filename should end with .gz when gzipped
-1 <infile> [PE] FASTQ-formatted R1 input file; filename should end with .gz when gzipped
-2 <infile> [PE] FASTQ-formatted R2 input file; filename should end with .gz when gzipped
-a <infile> [SE/PE] input file name containing alien sequence(s); one line per sequence;
lines starting with '>', '%' or '#' are not considered
--a1 <infile> [PE] same as -a for only R1 reads
--a2 <infile> [PE] same as -a for only R2 reads
-o <name> outfile basename: [SE] <name>.fastq[.gz] or [PE] <name>.{1,2,S}.fastq[.gz];
.gz is added when using option -z
-k [5-15] k-mer length k for alien sequence occurence searching; must lie between 5 and
15 (default: 10)
-q [0-40] Phred quality score cutoff to define low-quality bases; must lie between 0
and 40 (default: 13)
-m <int> maximum no. allowed successive non-troublesome bases in the 5'/3' regions to
be trimmed (default: k-1)
-l <int> minimum allowed read length (default: 50)
-p [0-100] maximum allowed percentage of low-quality bases per read (default: 50)
--p64 Phred+64 FASTQ input file(s) (default: Phred+33)
-z gzipped output files (default: not set)
-v verbose mode (default: not set)
EXAMPLES:
[SE] AlienTrimmer -i reads.fq -c aliens.fa -o trim -l 30 -p 20
[SE] AlienTrimmer -i reads.fq.gz -c aliens.txt -o trim -k 9 -q 13
[PE] AlienTrimmer -1 r1.fq -2 r2.fq -c aliens.fa -o trim -m 8 -p 25 -v
[PE] AlienTrimmer -1 r2.fq.gz -2 r2.fq.gz --a1 fwd.fa --a2 rev.fa -o trim -z
Since v2.0, trimming criteria to filter out troublesome bases (i.e. alien k-mers and/or non-confident bases) have been modified: ```c ## 3’ read: ….ACGTACTACGTACGTAGTACGTACGT troublesome: * * ************ trimming: <<<<<<<<<<<<<<<<<< | | | e t l
t: index of the last troublesome base e: index <= t such that base e is troublesome l: read length
AlienTrimmer trims off the longest suffix [e,l-1] such that:
## 5’
read: ACGTACTACGTACGTAGTACGTACGT…. troublesome: * ****** * * * trimming: >>>>>>>>>>>>>>>> | | t s
t: index of the first troublesome base s: index >= t (and < e) such that base s-1 is troublesome
AlienTrimmer trims off the longest prefix [0,s-1] such that:
Reading gzipped FASTQ files does not seem to have a negative impact on the overall running times. However, writing gzipped FASTQ output files (option -z) requires approximately 5 times slower running times.
The verbose mode (option -v) can be used to observe the trimming details.
The two files example.fastq.gz and aliens.fa can be found in the directory example/. The gzipped file example.fastq.gz contains five FASTQ-formatted reads, and the FASTA-formatted file aliens.fa contains three oligonucleotide sequences to be trimmed off: an indexed TruSeq adapter and the two homopolymeric segments poly-A and poly-C. Of note, it is highly recommended to use AlienTrimmer with these two last homopolymeric segments as aliens; indeed, library preparation oligonucleotides occurring in sequencing reads are often followed by a stretch of A’s or G’s to be also trimmed off (see e.g. Criscuolo and Brisse 2014).
The following command line can be run to filter out troublesome bases ending up in both 5’ and 3’ ends:
AlienTrimmer -i example.fastq.gz -a alien.fa -o example.trim -vAs the verbose mode is set (option -v), the following information can be read:
AlienTrimmer
FASTQ file: example.fastq.gz
main options: -k 10 -m 9 -q 13 -l 50 -p 50
outfile: example.trim.fastq
no. alien k-mers: 118
@HUB022:69:LATEUSH:2:1102:17743:8484 1:N:0:ATCCTTCC
========================================
TTCGTAATTGAGTTCCATCAAGAGCAAACTTATCGAGATCGAGTCAATTATTAACGTGTTCAATCAGTGCTTTTCCTAATTCAGCAGCTTCTGAATCGCCGCTATAGGTGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCCTT
* * * * *
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
@HUB022:69:LATEUSH:2:1103:25789:13463 1:N:0:ATCTTTCC
===================================== ============================ ===========
TTGCACATCAATGTAGTCAAACTCGCAAATGGAAAGAATTAGAAAAAGATTTCTTTAAAAAATTATGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTTTCCATCTCGTATGCCGTCTTCTGCTTGAAAATGTGGGGGGGGGGG
* * * * * * * ** ** * * * * * * * * ** * * * * ** * ***
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
@HUB022:69:LATEUSH:2:1104:16893:2253 1:N:0:ATCCTTCC
===========
ATTTGCGCTCAAAAAAAGACAACAAAGATAATTGATTTTTTTTTTTAAACATCAGAAGAAAACTTCTCCACACAACGAACAAACATTTCTACACCCATAGACAAAACAGTTTCATCAAAATCAAAACGAGGATGATGATGAGGATAAGCTA
* * ** *** **** * * * ** *** * *** * *** * *
>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<<<<<<<<<
@HUB022:69:LATEUSH:2:1105:17562:2597 1:N:0:ATCCTTCC [DISCARDED]
==================== ======================= ========================================
TTGTTGAAACATCACCCCCCCCCCCCCCCCCCCCACCCACCCCCCCCCCCCCCCCCCCCCCCACCAATTAAAAAAAAACCAAAAATAGGAAACATAAAAATAATATATAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
* * *********** ********** ** * ****** **** *** ** ** ****** **** * * * * * * * * *
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
infile: 5 reads 755 bases
outfile: 4 reads 429 bases
Total running time: 0min 00sec
Each trimmed read is displayed with highlighted troublesome bases, i.e. alien k-mers (=) and non-confident bases (*). Trimmed regions are indicated with > (5’) and < (3’).
The two first reads end up with the specified TruSeq adapter, and both reads are trimmed off accordingly.
The third read contains many non-confident bases in both 5’ and 3’ ends, which are trimmed off accordingly.
The fourth read seems artefactual, as it is made up by homopolymeric regions and non-confident bases. After trimming, only 13 bases remain and are therefore discarded, i.e. minimum length = 50 bases (option -l).
Criscuolo A, Brisse S (2013) ALIENTRIMMER: A tool to quickly and accurately trim off multiple short contaminant sequences from high-throughput sequencing reads. Genomics, 102(5-6):500-506. doi:10.1016/j.ygeno.2013.07.011
Criscuolo A, Brisse S (2014) AlienTrimmer removes adapter oligonucleotides with high sensitivity in short-insert paired-end reads. Commentary on Turner (2014) Assessment of insert sizes and adapter content in FASTQ data from NexteraXT libraries. Frontiers in Genetics, 5:130. doi:10.3389/fgene.2014.00130