This repository contains instructions for processing and repeat analysis of sequence data generated with the PacBio No-Amp Targeted Sequencing Protocol with simplified double Cas9 cut.
UPDATE: RepeatAnalysis Tools in this repository now use Python 3.
Outputs from the analysis scripts include high-accuracy (>=QV20) CCS sequences for target regions so that users can easily analyze the results with other third party tools as necessary.
An example dataset with repeat-expansion genotypes for HTT and FMR1 can be found here
Repeat analysis requires 3 basic steps 1. CCS (HiFi) 2. Demultiplexing 3. Alignment
We recommend using the latest CCS version for processing repeat-expansion sequence on the command line.
With improvements to CCS versions 5+, previously problematic very long repeat expansions now generate output ccs reads on default settings. With the addition of the --all option to CCS, any sequencing well that produces subreads will have representative data in the output of ccs. See CCS –all for details. We are continually trying to improve on the CCS algorithm, so please contact us if you encounter cases where you see many unpolished consensus reads in ccs outputs.
For customers still using CCS v4.2 (part of SMRT Link v9.0.0), we recommend upgrading from the links above. If you must use v4.2, please add the options noted below.
The wrapper script preprocess.sh is provided below as a single-command for running all three preprocessing steps.
In order to get the maximum yield for the longest expansion alleles, we need to run ccs with heuristics turned off and full-length draft mode:
$ ccs in.subreads.bam out.ccs.bam --all
For version 4.2
$ ccs in.subreads.bam out.ccs.bam --disable-heuristics --draft-mode full
Running ccs in this mode will be considerably slower than running on default, so it is recommended to chunk the ccs calls if you have access to a cluster. The ccs program has built-in chunking capabilities. See the script chunkCCS.sh for an example of chunking ccs on the command line.
This command will start 16 chunked jobs with 9 threads each using qsub:
$ ./chunkCCS.sh 16 9 cluster ccs in.subreads.bam out.ccs.bam --all
For version 4.2
$ ./chunkCCS.sh 16 9 cluster ccs in.subreads.bam out.ccs.bam --disable-heuristics --draft-mode full
This command will start 4 ccs jobs with 4 threads each on the local machine
$ ./chunkCCS.sh 4 4 local ccs in.subreads.bam out.ccs.bam --all
For version 4.2
$ ./chunkCCS.sh 4 4 local ccs in.subreads.bam out.ccs.bam --disable-heuristics --draft-mode full
Demultiplexing of the CCS reads is done with the program lima.
$ lima --ccs --same \
--split-bam-named --peek-guess \
inCCS.bam barcodes.fasta demuxCCS.bam
A summary of the demultiplexing outputs can be found in the lima output directory with the suffix *summary.
In order to align long expansion repeats through short reference seqeunce, we provide a set of modified parameters to the program pbmm2 for alignment.
$ pbmm2_extention.sh human_hs37d5.fasta ccs.bam mapped.ccs.bam sampleName
For human samples, we recommend alignment to the reference hs37d5. Example targets listed in the BED file below have hs37d5 coordinates. However, any reference will work so long as the target coordinates are paired with the reference used.
A wrapper script preprocess.sh is provided for one-step preprocessing from subreads -> ccs -> demux -> align. This script can run “local” on the executing machine or will submit to a cluster using qsub.
To run preproccesing on the cluster with 32 chunks and 8 procs per chunk:
$ preprocess.sh subreads.bam|xml barcodes.fasta|xml reference.fasta outdir 32 8 cluster
Following completion of the script, three folders will be created in the output directory ccs, demux, and align. BAM files in the align subdirectory are ready for analysis in the repeat analysis reporting scripts below.
Once the data are processed as above, the aligned BAM files are used as inputs to the following scripts for extraction and reporting of results.
We recommend IGV v2.5.x (or later) to visualize the aligned BAM file generated for each CCS Mapping job.
Repeat expansions are clearly labeled in IGV, and reads can be grouped into haplotypes.
The script makeReports.sh is provided to generate all reports in a single command. Please see below for examples of individual tools as well as target BED format. This script uses the default python instance in the command path – edit the script to use a different instance as needed.
$ makeReports.sh -h
Usage: makeReports.sh targets.BED reference.fasta outputDir aligned1.bam [aligned2.bam aligned3.bam ...]
The file [outputDir]/runReportCmds.sh contains commands used for generating the reports.
Generate table of ZMW counts per target. ### Usage $ python countOnTarget.py -h usage: countOnTarget.py [-h] [-o,–outdir OUTDIR] inBAM inBED
Generate table of ZMW counts per target
positional arguments:
inBAM BAM file of aligned reads. Must have .bai index
inBED BED file with targets
optional arguments:
-h, --help show this help message and exit
-o,--outdir OUTDIR directory to save output file. default cwd.
$ python countOnTarget.py combined.consensusalignmentset.bam resources/human_hs37d5.targets.bed
$ column -ts, onTargetCounts.tsv
name ctg start end length expected onTargetZMWs enrichment
HTT 4 3076604 3076693 89 0.0018 408 227454.0622
C9orf72 9 27573435 27573596 161 0.0017 210 120320.2169
FMR1 X 146993569 146993628 59 0.0018 242 135015.6210
ATXN10 22 46191235 46191304 69 0.0018 268 149907.1604
$ column -t resources/human_hs37d5.targets_repeatonly.bed
4 3076604 3076693 HTT CAG,CAA,CCG,CCA,CGG 0
9 27573435 27573596 C9orf72 GGGGCC,GGGGCG 1
X 146993569 146993628 FMR1 CGG,AGG 0
22 46191235 46191304 ATXN10 ATTCT,ATTCCT,ATTTCT,ATTCC 0
Columns are: {chr} {start} {stop} {name} {motifs} {revcomp}
The final column revcomp is optional and indicates whether the aligned sequence should be reverse complemented (1) or not (0) before exporting extracted sequence. This is useful in cases where the reference sequence used is the opposite strand compared to the typical orientation.
Generate coverage plot of results. (Example has 4 multiplexed targets) ### Example $python coveragePlot.py combined.consensusalignmentset.bam
Add target labels:
$python coveragePlot.py combined.consensusalignmentset.bam -t resources/human_hs37d5.targets.bed
The following tools are provided to enable simplified reporting of repeat expansion.
Click here for Previous Repeat Reporting Tools.
K-means clustering of reads based on kmer counts over the repeat region of interest provides a reliable way to phase alleles. Output includes haplotagged BAM (tag=“HP”) and summary stats for target motifs. ### Usage $ python clusterByRegion.py -h usage: clusterByRegion.py [-h] -m,–motifs MOTIFS [-k,–kmer KMER] [-c,–clusters CLUSTERS] [-r,–revcomp] [-p,–prefix PREFIX] [-f,–flanksize FLANKSIZE] [-s,–seed SEED] [-x,–noBam] [-d,–drop] [-u,–collapseHP] inBAM reference region
kmer clustering by target region
positional arguments:
inBAM input BAM of CCS alignments
reference Reference fasta used for mapping BAM. Must have .fai
index.
region Target region, format '[chr]:[start]-[stop]'. Example
'4:3076604-3076660'
optional arguments:
-h, --help show this help message and exit
-m,--motifs MOTIFS comma-separated list of motifs to count
-k,--kmer KMER kmer size for clustering. Default 3
-c,--clusters CLUSTERS
clusters/ploidy count. Default 2
-r,--revcomp Reverse complement extracted sequence
-p,--prefix PREFIX Output prefix. Default ./cluster
-f,--flanksize FLANKSIZE
Size of flanking sequence mapped for extracting repeat
region. Default 100
-s,--seed SEED Seed for resampling ci95. Default 42
-x,--noBam Do not export HP-tagged bam of clustered reads
-d,--drop Drop reads with no cluster in output bam. Default keep
all reads.
-u,--collapseHP Collapse homopolymers before analysis. Default use
original sequence.
$ python clusterByRegion.py -m CGG,AGG \
-p cluster/FMR1 \
-d \
combined.consensusalignmentset.bam \
human_hs37d5.fasta \
'X:146993569-146993628'
$ column -ts, cluster/FMR1.summary.csv
CGG CGG CGG AGG AGG AGG totalBp totalBp totalBp Read
median mean ci95 median mean ci95 median mean ci95 count
cluster0_numreads86 320.5 320.1 (266 - 384) 1 1.1 (0 - 3) 985.5 988.0 (857 - 1168) 86
cluster1_numreads151 27.0 27.0 (26 - 28) 2 2.0 (2 - 2) 87.0 87.2 (84 - 90) 151
$ head cluster/FMR1.readnames.txt
>cluster0_numreads86
m64012_190806_011308/22087479/ccs/295_1272
m64012_190806_011308/172818496/ccs/294_1254
m64012_190806_011308/48760706/ccs/296_1331
m64012_190806_011308/180027489/ccs/289_1286
m64012_190806_011308/43582972/ccs/295_1228
$ python extractRegion.py combined.consensusalignmentset.bam \
human_hs37d5.fasta \
'X:146993569-146993628' | head
@m64012_190806_011308/66977880/ccs/296_380
CGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGG
+
~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
@m64012_190806_011308/178717562/ccs/296_383
CGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGG
+
~~~~~~~~~y~~~~~~~~u~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
@m64012_190806_011308/39650860/ccs/295_382
CGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGG
$ python extractRegion.py combined.consensusalignmentset.bam \
human_hs37d5.fasta \
'X:146993569-146993628' \
| python waterfall.py -m CGG,AGG -o FMR1.png
$ python extractRegion.py combined.consensusalignmentset.bam \
human_hs37d5.fasta \
'X:146993569-146993628' \
| python countMotifs.py -m CGG,AGG | column -ts,
readName CGG AGG totalLength
m64012_190806_011308/39650860/ccs/295_382 27 2 87
m64012_190806_011308/39651811/ccs/295_382 27 2 87
m64012_190806_011308/41092035/ccs/295_382 27 2 87
m64012_190806_011308/155584458/ccs/296_383 27 2 87
m64012_190806_011308/46597674/ccs/295_382 27 2 87
...
m64012_190806_011308/169740995/ccs/294_1298 326 1 1004
m64012_190806_011308/131729381/ccs/295_1300 333 1 1005
m64012_190806_011308/99680942/ccs/294_1299 323 1 1005
m64012_190806_011308/134742966/ccs/296_1302 331 1 1006
m64012_190806_011308/177735643/ccs/282_1290 328 1 1008
m64012_190806_011308/8391101/ccs/295_1304 333 1 1009
$ python extractRegion.py combined.consensusalignmentset.bam \
human_hs37d5.fasta \
'X:146993569-146993628' \
| python plotCounts.py -m CGG -n FMR1

This is a simple tool for extracting a target region from aligned CCS reads. The target region is extracted by aligning the sequence immediately flanking the target to each CCS read intersecting the target. ### Dependencies - pysam - mappy ### Usage $ python extractRegion.py -h usage: extractRegion.py [-h] [-o,–outFq OUTFQ] [-f,–flanksize FLANKSIZE] [-r,–revcomp] inBAM reference region
extract target region from aligned BAMS using region flank alignments. Output
format is fastq
positional arguments:
inBAM input BAM of CCS alignments
reference Reference fasta used for mapping BAM. Must have .fai
index.
region Target region, format '[chr]:[start]-[stop]'. Example
'4:3076604-3076660'
optional arguments:
-h, --help show this help message and exit
-o,--outFq OUTFQ Output fastq file. Default stdout
-f,--flanksize FLANKSIZE
Size of flanking sequence mapped for extracting repeat
region. Default 100
-r,--revcomp Rev-comp extracted region. Default Reference Direction
$ python extractRegion.py combined.consensusalignmentset.bam \
human_hs37d5.fasta \
4:3076604-3076660 | head
@m54006_190117_155211/10616973/ccs/2259_2304
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
+
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
@m54006_190117_155211/10879182/ccs/2259_2307
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
+
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
@m54006_190117_155211/12386712/ccs/2259_2307
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
This generates a waterfall-style plot from a fastx file (or stdin) of extracted repeat regions. ### Dependencies - pbcore - matplotlib - numpy
$ python waterfall.py -h
usage: waterfall.py [-h] [-i,--inFastx INFASTX] -o,--out OUT -m,--motifs
MOTIFS [-f,--format FORMAT] [-d,--dpi DPI]
quick waterfall plot from fastx of extracted repeat sequences
optional arguments:
-h, --help show this help message and exit
-i,--inFastx INFASTX Input Fastx file. Default stdin
-o,--out OUT Output file
-m,--motifs MOTIFS Search motifs, comma separated, most frequent first,
e.g. 'CGG,AGG'
-f,--format FORMAT Image format. Default png
-d,--dpi DPI Image resolution. Default 400
$ python waterfall.py -i extractedSequence_FMR1.fasta -m CGG,AGG -o FMR1.png
This plot will read a fastx file (or stdin) of extracted repeat regions and generate counts of exact motif string matches. ### Dependencies - pbcore - numpy
$ python countMotifs.py -h
usage: countMotifs.py [-h] [-i,--inFastx INFASTX] [-o,--out OUT] -m,--motifs
MOTIFS [-s,--sep SEP] [-r,--reverse]
quick count of motifs per read from fastx of extracted repeat sequences
optional arguments:
-h, --help show this help message and exit
-i,--inFastx INFASTX Input Fastx file. Default stdin
-o,--out OUT Output csv. Default stdout
-m,--motifs MOTIFS Search motifs, comma separated, most frequent first,
e.g. 'CGG,AGG'
-s,--sep SEP Field separator. Default ','
-r,--reverse Sort largest first. Default ascending order
$ python countMotifs.py -i extractedSequence_FMR1.fasta -m CGG,AGG | column -ts,
readName CGG AGG totalLength
m54006_190116_193234/56885460/ccs/298_388 28 2 90
m54006_190116_193234/17367745/ccs/299_391 29 1 92
m54006_190116_193234/20840638/ccs/298_391 29 2 93
m54006_190116_193234/9044396/ccs/300_393 29 2 93
m54006_190116_193234/18481434/ccs/298_391 29 2 93
m54006_190116_193234/18940755/ccs/298_391 29 2 93
m54006_190116_193234/19136687/ccs/298_391 29 2 93
m54006_190116_193234/20644190/ccs/298_391 29 2 93
m54006_190116_193234/16778121/ccs/298_391 29 2 93
Plot histograms of repeated motif counts and total repeat region ### Dependencies - pbcore - matplotlib - seaborn
$ python plotCounts.py -h
usage: plotCounts.py [-h] [-i,--inFastx INFASTX] [-o,--out OUT] -m,--motif
MOTIF [-n,--name NAME] [-f,--format FORMAT]
[-d,--dpi DPI]
generate histograms of motif counts and expansion size
optional arguments:
-h, --help show this help message and exit
-i,--inFastx INFASTX Input Fastx file. Default stdin
-o,--out OUT Output prefix. default 'hist'
-m,--motif MOTIF Search motif
-n,--name NAME Title/name for figure
-f,--format FORMAT Image format. Default png
-d,--dpi DPI Image resolution. Default 400
$ python plotCounts.py -m CGG -n FMR1 -i extractedSequence_FMR1.fasta