File formats for Multiple Sequence Alignments (MSA)

ClustalW format

The ClustalW format is a relatively simple text file containing a single multiple sequence alignment of DNA, RNA, or protein sequences. It was first used as an output format for the clustalw programs, but nowadays it may also be generated by various other sequence alignment tools. The specification is straight forward:

The first line starts with the words
```
CLUSTAL W 
```
or
```
CLUSTALW 
```
After the above header there is at least one empty line
Finally, one or more blocks of sequence data are following, where each block is separated by at least one empty line

Each line in a blocks of sequence data consists of the sequence name followed by the sequence symbols, separated by at least one whitespace character. Usually, the length of a sequence in one block does not exceed 60 symbols. Optionally, an additional whitespace separated cumulative residue count may follow the sequence symbols. Optionally, a block may be followed by a line depicting the degree of conservation of the respective alignment columns.

Note: Sequence names and the sequences must not contain whitespace characters! Allowed gap symbols are the hyphen ("-"), and dot (".").

Warning: Please note that many programs that output this format tend to truncate the sequence names to a limited number of characters, for instance the first 15 characters. This can destroy the uniqueness of identifiers in your MSA.

Here is an example alignment in ClustalW format:

CLUSTAL W (1.83) multiple sequence alignment


AL031296.1/85969-86120      CUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUAC
AANU01225121.1/438-603      CUGCCUCACAACAUUUGUGCCUCAGUUACUCAUAGAUGUAGUGAGGGUGACAAUACUUAC
AAWR02037329.1/29294-29150  ---CUCGACACCACU---GCCUCGGUUACCCAUCGGUGCAGUGCGGGUAGUAGUACCAAU

AL031296.1/85969-86120      UCUCGUUGGUGAUAAGGAACAGCU
AANU01225121.1/438-603      UCUCGUUGGUGAUAAGGAACAGCU
AAWR02037329.1/29294-29150  GCUAAUUAGUUGUGAGGACCAACU

Stockholm 1.0 format

Here is an example alignment in Stockholm 1.0 format:

# STOCKHOLM 1.0

#=GF AC   RF01293
#=GF ID   ACA59
#=GF DE   Small nucleolar RNA ACA59
#=GF AU   Wilkinson A
#=GF SE   Predicted; WAR; Wilkinson A
#=GF SS   Predicted; WAR; Wilkinson A
#=GF GA   43.00
#=GF TC   44.90
#=GF NC   40.30
#=GF TP   Gene; snRNA; snoRNA; HACA-box;
#=GF BM   cmbuild -F CM SEED
#=GF CB   cmcalibrate --mpi CM
#=GF SM   cmsearch --cpu 4 --verbose --nohmmonly -E 1000 -Z 549862.597050 CM SEQDB
#=GF DR   snoRNABase; ACA59;
#=GF DR   SO; 0001263; ncRNA_gene;
#=GF DR   GO; 0006396; RNA processing;
#=GF DR   GO; 0005730; nucleolus;
#=GF RN   [1]
#=GF RM   15199136
#=GF RT   Human box H/ACA pseudouridylation guide RNA machinery.
#=GF RA   Kiss AM, Jady BE, Bertrand E, Kiss T
#=GF RL   Mol Cell Biol. 2004;24:5797-5807.
#=GF WK   Small_nucleolar_RNA
#=GF SQ   3


AL031296.1/85969-86120     CUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
AANU01225121.1/438-603     CUGCCUCACAACAUUUGUGCCUCAGUUACUCAUAGAUGUAGUGAGGGUGACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
AAWR02037329.1/29294-29150 ---CUCGACACCACU---GCCUCGGUUACCCAUCGGUGCAGUGCGGGUAGUAGUACCAAUGCUAAUUAGUUGUGAGGACCAACU
#=GC SS_cons               -----((((,<<<<<<<<<___________>>>>>>>>>,,,,<<<<<<<______>>>>>>>,,,,,))))::::::::::::
#=GC RF                    CUGCcccaCAaCacuuguGCCUCaGUUACcCauagguGuAGUGaGgGuggcAaUACccaCcCucgUUgGuggUaAGGAaCAgCU
//

See also: Washington University Secondary Structure (WUSS) notation on legal characters for the consensus secondary structure line SS_cons and their interpretation

FASTA (Pearson) format

Note: Sequence names must not contain whitespace characters. Otherwise, the parts after the first whitespace will be dropped. The only allowed gap character is the hyphen ("-").

Here is an example alignment in FASTA format:

>AL031296.1/85969-86120
CUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUAC
UCUCGUUGGUGAUAAGGAACAGCU
>AANU01225121.1/438-603
CUGCCUCACAACAUUUGUGCCUCAGUUACUCAUAGAUGUAGUGAGGGUGACAAUACUUAC
UCUCGUUGGUGAUAAGGAACAGCU
>AAWR02037329.1/29294-29150
---CUCGACACCACU---GCCUCGGUUACCCAUCGGUGCAGUGCGGGUAGUAGUACCAAU
GCUAAUUAGUUGUGAGGACCAACU

MAF format

The multiple alignment format (MAF) is usually used to store multiple alignments on DNA level between entire genomes. It consists of independent blocks of aligned sequences which are annotated by their genomic location. Consequently, an MAF formatted MSA file may contain multiple records. MAF files start with a line

##maf

which is optionally extended by whitespace delimited key=value pairs. Lines starting with the character ("#") are considered comments and usually ignored.

A MAF block starts with character ("a") at the beginning of a line, optionally followed by whitespace delimited key=value pairs. The next lines start with character ("s") and contain sequence information of the form

s src start size strand srcSize sequence

where

src is the name of the sequence source
start is the start of the aligned region within the source (0-based)
size is the length of the aligned region without gap characters
strand is either ("+") or ("-"), depicting the location of the aligned region relative to the source
srcSize is the size of the entire sequence source, e.g. the full chromosome
sequence is the aligned sequence including gaps depicted by the hyphen ("-")

Here is an example alignment in MAF format (bluntly taken from the UCSC Genome browser website):

##maf version=1 scoring=tba.v8 
# tba.v8 (((human chimp) baboon) (mouse rat)) 
# multiz.v7
# maf_project.v5 _tba_right.maf3 mouse _tba_C
# single_cov2.v4 single_cov2 /dev/stdin
                   
a score=23262.0     
s hg16.chr7    27578828 38 + 158545518 AAA-GGGAATGTTAACCAAATGA---ATTGTCTCTTACGGTG
s panTro1.chr6 28741140 38 + 161576975 AAA-GGGAATGTTAACCAAATGA---ATTGTCTCTTACGGTG
s baboon         116834 38 +   4622798 AAA-GGGAATGTTAACCAAATGA---GTTGTCTCTTATGGTG
s mm4.chr6     53215344 38 + 151104725 -AATGGGAATGTTAAGCAAACGA---ATTGTCTCTCAGTGTG
s rn3.chr4     81344243 40 + 187371129 -AA-GGGGATGCTAAGCCAATGAGTTGTTGTCTCTCAATGTG
                   
a score=5062.0                    
s hg16.chr7    27699739 6 + 158545518 TAAAGA
s panTro1.chr6 28862317 6 + 161576975 TAAAGA
s baboon         241163 6 +   4622798 TAAAGA 
s mm4.chr6     53303881 6 + 151104725 TAAAGA
s rn3.chr4     81444246 6 + 187371129 taagga

a score=6636.0
s hg16.chr7    27707221 13 + 158545518 gcagctgaaaaca
s panTro1.chr6 28869787 13 + 161576975 gcagctgaaaaca
s baboon         249182 13 +   4622798 gcagctgaaaaca
s mm4.chr6     53310102 13 + 151104725 ACAGCTGAAAATA

File formats to manipulate the RNA folding grammar

Command Files

The RNAlib and many programs of the ViennaRNA Package can parse and apply data from so-called command files. These commands may refer to structure constraints or even extensions of the RNA folding grammar (such as Unstructured Domains). Commands are given as a line of whitespace delimited data fields. The syntax we use extends the constraint definitions used in the mfold / UNAfold software, where each line begins with a command character followed by a set of positions.
However, we introduce several new commands, and allow for an optional loop type context specifier in form of a sequence of characters, and an orientation flag that enables one to force a nucleotide to pair upstream, or downstream.

Constraint commands

The following set of commands is recognized:

F $\ldots$ Force
P $\ldots$ Prohibit
C $\ldots$ Conflicts/Context dependency
A $\ldots$ Allow (for non-canonical pairs)
E $\ldots$ Soft constraints for unpaired position(s), or base pair(s)

RNA folding grammar exensions

UD $\ldots$ Add ligand binding using the Unstructured Domains feature

Specification of the loop type context

The optional loop type context specifier [LOOP] may be a combination of the following:

E $\ldots$ Exterior loop
H $\ldots$ Hairpin loop
I $\ldots$ Interior loop
M $\ldots$ Multibranch loop
A $\ldots$ All loops

For structure constraints, we additionally allow one to address base pairs enclosed by a particular kind of loop, which results in the specifier [WHERE] which consists of [LOOP] plus the following character:

i $\ldots$ enclosed pair of an Interior loop
m $\ldots$ enclosed pair of a Multibranch loop

If no [LOOP] or [WHERE] flags are set, all contexts are considered (equivalent to A )

Controlling the orientation of base pairing

For particular nucleotides that are forced to pair, the following [ORIENTATION] flags may be used:

U $\ldots$ Upstream
D $\ldots$ Downstream

If no [ORIENTATION] flag is set, both directions are considered.

Sequence coordinates

Sequence positions of nucleotides/base pairs are $ 1- $ based and consist of three positions $ i $ , $ j $ , and $ k $ . Alternativly, four positions may be provided as a pair of two position ranges $ [i:j] $ , and $ [k:l] $ using the '-' sign as delimiter within each range, i.e. $ i-j $ , and $ k-l $ .

Valid constraint commands

Below are resulting general cases that are considered valid constraints:

"Forcing a range of nucleotide positions to be paired":
Syntax:
F i 0 k [WHERE] [ORIENTATION]

Description:
Enforces the set of consecutive nucleotides starting at position to be paired. The optional loop type specifier [WHERE] allows to force them to appear as closing/enclosed pairs of certain types of loops.
"Forcing a set of consecutive base pairs to form":
Syntax:
```
F i j k [WHERE] 
```
Description:
Enforces the base pairs to form. The optional loop type specifier [WHERE] allows to specify in which loop context the base pair must appear.
"Prohibiting a range of nucleotide positions to be paired":
Syntax:
```
P i 0 k [WHERE] 
```
Description:
Prohibit a set of consecutive nucleotides to participate in base pairing, i.e. make these positions unpaired. The optional loop type specifier [WHERE] allows to force the nucleotides to appear within the loop of specific types.
"Probibiting a set of consecutive base pairs to form":
Syntax:
```
P i j k [WHERE] 
```
Description:
Probibit the base pairs to form. The optional loop type specifier [WHERE] allows to specify the type of loop they are disallowed to be the closing or an enclosed pair of.
"Prohibiting two ranges of nucleotides to pair with each other":
Syntax:
```
P i-j k-l [WHERE] 
```
Description:
Prohibit any nucleotide to pair with any other nucleotide . The optional loop type specifier [WHERE] allows to specify the type of loop they are disallowed to be the closing or an enclosed pair of.
"Enforce a loop context for a range of nucleotide positions":
Syntax:
```
C i 0 k [WHERE] 
```
Description:
This command enforces nucleotides to be unpaired similar to prohibiting nucleotides to be paired, as described above. It too marks the corresponding nucleotides to be unpaired, however, the [WHERE] flag can be used to enforce specfic loop types the nucleotides must appear in.
"Remove pairs that conflict with a set of consecutive base pairs":
Syntax:
```
C i j k 
```
Description:
Remove all base pairs that conflict with a set of consecutive base pairs . Two base pairs and conflict with each other if , or .
"Allow a set of consecutive (non-canonical) base pairs to form":
Syntax:
A i j k [WHERE]

Description:
This command enables the formation of the consecutive base pairs $(i,j), \ldots, (i+(k-1), j-(k-1))$ , no matter if they are canonical, or non-canonical. In contrast to the above F and W commands, which remove conflicting base pairs, the A command does not. Therefore, it may be used to allow non-canoncial base pair interactions. Since the RNAlib does not contain free energy contributions $E_{ij}$ for non-canonical base pairs , they are scored as the maximum of similar, known contributions. In terms of a Nussinov like scoring function the free energy of non-canonical base pairs is therefore estimated as
$E_{ij} = \min \left[ \max_{(i,k) \in \{GC, CG, AU, UA, GU, UG\}} E_{ik}, \max_{(k,j) \in \{GC, CG, AU, UA, GU, UG\}} E_{kj} \right].$
The optional loop type specifier [WHERE] allows to specify in which loop context the base pair may appear.
"Apply pseudo free energy to a range of unpaired nucleotide positions":
Syntax:
E i 0 k e

Description:
Use this command to apply a pseudo free energy of to the set of consecutive nucleotides, starting at position . The pseudo free energy is applied only if these nucleotides are considered unpaired in the recursions, or evaluations, and is expected to be given in .
"Apply pseudo free energy to a set of consecutive base pairs":
Syntax
E i j k e

Use this command to apply a pseudo free energy of to the set of base pairs $(i,j), \ldots, (i+(k-1), j-(k-1))$ . Energies are expected to be given in .

Valid domain extensions commands

"Add ligand binding to unpaired motif (a.k.a. unstructured domains)":
Syntax:
UD m e [LOOP]

Description:
Add ligand binding to unpaired sequence motif (given in IUPAC format, capital letters) with binding energy in particular loop type(s).
Example:
UD AAA -5.0 A

The above example applies a binding free energy of for a motif AAA that may be present in all loop types.

Table of Contents