HelloWorld (Perl/Python)

Table of Contents

• Perl5
• Python

Perl5

Simple MFE prediction for a given sequence

use RNA;

# The RNA sequence
my $seq = "GAGUAGUGGAACCAGGCUAUGUUUGUGACUCGCAGACUAACA";

# compute minimum free energy (MFE) and corresponding structure
my ($ss, $mfe) = RNA::fold($seq);

# print output
printf "%s\n%s [ %6.2f ]\n", $seq, $ss, $mfe;

Simple MFE prediction for a multiple sequence alignment

use RNA;

# The RNA sequence alignment
my @sequences = (
    "CUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGU",
    "CUGCCUCACAACAUUUGUGCCUCAGUUACUCAUAGAUGUAGUGAGGGU",
    "---CUCGACACCACU---GCCUCGGUUACCCAUCGGUGCAGUGCGGGU"
);

# compute the consensus sequence
my $cons = RNA::consensus(\@sequences);

# predict Minmum Free Energy and corresponding secondary structure
my ($ss, $mfe) = RNA::alifold(\@sequences);

# print output
printf "%s\n%s [ %6.2f ]\n", $cons, $ss, $mfe;

Deviating from the Default Model

use RNA;

# The RNA sequence
my $seq = "GAGUAGUGGAACCAGGCUAUGUUUGUGACUCGCAGACUAACA";

# create a new model details structure
my $md = new RNA::md();

# change temperature and dangle model
$md->{temperature} = 20.0; # 20 Deg Celcius
$md->{dangles}     = 1;    # Dangle Model 1

# create a fold compound
my $fc = new RNA::fold_compound($seq, $md);

# predict Minmum Free Energy and corresponding secondary structure
my ($ss, $mfe) = $fc->mfe();

# print sequence, structure and MFE
printf "%s\n%s [ %6.2f ]\n", $seq, $ss, $mfe;

Python

Simple MFE prediction for a given sequence

import RNA

# The RNA sequence
seq = "GAGUAGUGGAACCAGGCUAUGUUUGUGACUCGCAGACUAACA"

# compute minimum free energy (MFE) and corresponding structure
(ss, mfe) = RNA.fold(seq)

# print output
print "%s\n%s [ %6.2f ]" % (seq, ss, mfe)

Simple MFE prediction for a multiple sequence alignment

import RNA

# The RNA sequence alignment
sequences = [
    "CUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGU",
    "CUGCCUCACAACAUUUGUGCCUCAGUUACUCAUAGAUGUAGUGAGGGU",
    "---CUCGACACCACU---GCCUCGGUUACCCAUCGGUGCAGUGCGGGU"
]

# compute the consensus sequence
cons = RNA.consensus(sequences)

# predict Minmum Free Energy and corresponding secondary structure
(ss, mfe) = RNA.alifold(sequences);

# print output
print "%s\n%s [ %6.2f ]" % (cons, ss, mfe)

Deviating from the Default Model

import RNA

# The RNA sequence
seq = "GAGUAGUGGAACCAGGCUAUGUUUGUGACUCGCAGACUAACA"

# create a new model details structure
md = RNA.md()

# change temperature and dangle model
md.temperature = 20.0 # 20 Deg Celcius
md.dangles     = 1    # Dangle Model 1

# create a fold compound
fc = RNA.fold_compound(seq, md)

# predict Minmum Free Energy and corresponding secondary structure
(ss, mfe) = fc.mfe()

# print sequence, structure and MFE
print "%s\n%s [ %6.2f ]\n" % (seq, ss, mfe)