The Program RNAalifold

Introduction

RNAalifold generalizes the folding algorithm for multiple sequence alignments (MSA), treating the entire alignment as a single generalized sequence. To assign an energy to a structure on such a generalized sequence, the energy is simply averaged over all sequences in the alignment. This average energy is augmented by a covariance term, that assigns a bonus or penalty to every possible base pair (i,j) based on the sequence variation in columns i and j of the alignment.

Compensatory mutations are a strong indication of structural conservation, while consistent mutations provide a weaker signal. The covariance term used by RNAalifold therefore assigns a bonus of 1 kcal/mol to each consistent and 2 kcal/mol for each compensatory mutation. Sequences that cannot form a standard base pair incur a penalty of 1 kcal/mol. Thus, for every possible consensus pair between two columns i and j of the alignment a covariance score Cij is computed by counting the fraction of sequence pairs exhibiting consistent and compensatory mutations, as well as the fraction of sequences that are inconsistent with the pair. The weight of the covariance term relative to the normal energy function, as well as the penalty for inconsistent mutations can be changed via command line parameters.

Apart from the covariance term, the folding algorithm in RNAalifold is essentially the same as for single sequence folding. In particular, folding an alignment containing just one sequence will give the same result as single sequence folding using RNAfold. For N sequences of length n the required CPU time scales as O(Nn2+n3) while memory requirements grow as the square of the sequence length. Thus RNAalifold is in general faster than folding each sequence individually. The main advantage, however, is that the accuracy of consensus structure predictions is generally much higher than for single sequence folding, where typically only between 40% and 70% of the base pairs are predicted correctly.

Apart from prediction of MFE structures RNAalifold also implements an algorithm to compute the partition function over all possible (consensus) structures and the thermodynamic equilibrium probability for each possible pair. These base pairing probabilities are useful to see structural alternatives, and to distinguish well defined regions, where the predicted structure is most likely correct, from ambiguous regions.

As a first example we’ll produce a consensus structure prediction for the following four tRNA sequences.

$ cat > four.seq
>M10740 Yeast-PHE
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
>K00349 Drosophila-PHE
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCCGGUUCAAUCCCGGGUUUCGGCA
>K00283 Halobacterium volcanii Lys-tRNA-1
GGGCCGGUAGCUCAUUUAGGCAGAGCGUCUGACUCUUAAUCAGACGGUCGCGUGUUCGAAUCGCGUCCGGCCCA
>AF346993
CAGAGUGUAGCUUAACACAAAGCACCCAACUUACACUUAGGAGAUUUCAACUUAACUUGACCGCUCUGA

RNAalifold uses aligned sequences as input. Thus, our first step will be to align the sequences. We use clustalw2 in this example, since it’s one of the most widely used alignment programs and has been shown to work well on structural RNAs. Other alignment programs can be used (including programs that attempt to do structural alignment of RNAs), but for this example the resulting multiple sequence alignment should be in Clustal format. Get clustalw2 and install it as you have done it with the other packages: http://www.clustal.org/clustal2.

RNAalifold Output Files

Content of the alifold.out file:

4 sequence; length of alignment 78
alifold output
    6    72  0  99.8%   0.007 GC:2    GU:1    AU:1
   33    43  0  98.9%   0.033 GC:2    GU:1    AU:1
   31    45  0  99.0%   0.030 CG:3    UA:1
   15    25  0  98.9%   0.045 CG:3    UA:1
    5    73  1  99.7%   0.008 CG:2    GC:1
   13    27  0  99.1%   0.042 CG:4
   14    26  0  99.1%   0.042 UA:4
    4    74  1  99.5%   0.015 CG:3
[...]

The last output file produced by RNAalifold -p, named alifold.out, is a plain text file with detailed information on all plausible base pairs sorted by the likelihood of the pair. In the example above we see that the pair (6,72) has no inconsistent sequences, is predicted almost with probability 1, and occurs as a GC pair in two sequences, a GU pair in one, and a AU pair in another.

RNAalifold automatically produces a drawing of the consensus structure in Postscript format and writes it to the file alirna.ps. In the structure graph consistent and compensatory mutations are marked by a circle around the variable base(s), i.e. pairs where one pairing partner is encircled exhibit consistent mutations, whereas pairs supported by compensatory mutations have both bases marked. Pairs that cannot be formed by some of the sequences are shown gray instead of black.

The structure layout and dotplot files alirna.ps and alidot.ps should look as follows:

alirna alidot

In the example given, many pairs show such inconsistencies. This is because one of the sequences (AF346993) is not aligned well by clustalw.

Note

Subsequent calls to RNAalifold will overwrite any existing output alirna.ps (alidot.ps, alifold.out) files in the current directory. Be sure to rename any files you want to keep.

Structure predictions for the individual sequences

The consensus structure computed by RNAalifold will contain only pairs that can be formed by most of the sequences. The structures of the individual sequences will typically have additional base pairs that are not part of the consensus structure. Moreover, ncRNA may exhibit a highly conserved core structure while other regions are more variable. It may therefore be desirable to produce structure predictions for one particular sequence, while still using covariance information from other sequences.

This can be accomplished by first computing the consensus structure for all sequences using RNAalifold, then folding individual sequences using RNAfold -C with the consensus structure as a constraint. In constraint folding mode RNAfold -C allows only base pairs to form which are compatible with the constraint structure. This resulting structure typically contains most of the constraint (the consensus structure) plus some additional pairs that are specific for this sequence.

The refold.pl script removes gaps and maps the consensus structure to each individual sequence.

$ RNAalifold  RNaseP.aln > RNaseP.alifold
$ gv alirna.ps
$ refold.pl RNaseP.aln RNaseP.alifold | head -3 > RNaseP.cfold
$ RNAfold -C --noLP < RNaseP.cfold > RNaseP.refold
$ gv E-coli_ss.ps

If you compare the refolded structure (E-coli_ss.ps) with the structure you get by simply folding the E.coli sequence in the RNaseP.seq file (RNAfold --noLP) you find a clear rearrangement.

In cases where constrained folding results in a structure that is very different from the consensus, or if the energy from constrained folding is much worse than from unconstrained folding, this may indicate that the sequence in question does not really share a common structure with the rest of the alignment or is misaligned. One should then either remove or re-align that sequence and recompute the consensus structure.

Note

Note that since RNase P forms sizable pseudo-knots, a perfect prediction is impossible in this case.