User guide¶
Basic usage¶
If you just want to trim a 3' adapter, the basic command-line for cutadapt is:
cutadapt -a AACCGGTT -o output.fastq input.fastq
The sequence of the adapter is given with the -a option. Of course, you
need to replace AACCGGTT with your actual adapter sequence. Reads are read
from the input file input.fastq and written to the output file
output.fastq.
Cutadapt searches for the adapter in all reads and removes it when it finds it. All reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed entirely (because the adapter was found in the very beginning) are output. All of this can be changed with command-line options, explained further down.
A report is printed after cutadapt has finished processing the reads.
Input and output file formats¶
Input files for cutadapt need to be in one the these formats:
FASTA (file name extensions:
.fasta,.fa,.fna,.csfasta,.csfa)FASTQ (extensions:
.fastq,.fq)A pair of a FASTA file and a
.(cs)qualfile
The latter format is (or was) used for colorspace data from the SOLiD instruments.
The input file format is recognized from the file name extension (given in
parentheses in the list above). You can also explicitly specify which format
the input has by using the --format option.
The output format is the same as the input format, except for the FASTA/QUAL
pairs -- those will always be converted to FASTQ. Also, cutadapt does not check
the output file name: If you input FASTQ data, but use -o output.fasta, then
the output file will actually be in FASTQ format.
Compressed files¶
Cutadapt supports compressed input and output files. Whether an input file
needs to be decompressed or an output file needs to be compressed is detected
automatically by inspecting the file name: If it ends in .gz, then gzip
compression is assumed. You can therefore run cutadapt like this and it works
as expected:
cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz
All of cutadapt's options that expect a file name support this.
Files compressed with bzip2 (.bz2) or xz (.xz) are also supported, but
only if the Python installation includes the proper modules. xz files require
Python 3.3 or later.
Standard input and output¶
If no output file is specified via the -o option, then the output is sent to
the standard output stream. Instead of the example command line from above, you
can therefore also write:
cutadapt -a AACCGGTT input.fastq > output.fastq
There is one difference in behavior if you use cutadapt without -o: The
report is sent to the standard error stream instead of standard output. You
can redirect it to a file like this:
cutadapt -a AACCGGTT input.fastq > output.fastq 2> report.txt
Wherever cutadapt expects a file name, you can also write a dash (-) in
order to specify that standard input or output should be used. For example:
tail -n 4 input.fastq | cutadapt -a AACCGGTT - > output.fastq
The tail -n 4 prints out only the last four lines of input.fastq, which
are then piped into cutadapt. Thus, cutadapt will work only on the last read in
the input file.
In most cases, you should probably use - at most once for an input file and
at most once for an output file, in order not to get mixed output.
You cannot combine - and gzip compression since cutadapt needs to know the
file name of the output or input file. if you want to have a gzip-compressed
output file, use -o with an explicit name.
One last "trick" is to use /dev/null as an output file name. This special
file discards everything you send into it. If you only want to see the
statistics output, for example, and do not care about the trimmed reads at all,
you could use something like this:
cutadapt -a AACCGGTT -o /dev/null input.fastq
Read processing¶
Cutadapt can do a lot more in addition to removing adapters. There are various command-line options that make it possible to modify and filter reads and to redirect them to various output files. Each read is processed in the following way:
Read modification options are applied. This includes adapter removal, quality trimming, read name modifications etc.
Filtering options are applied, such as removal of too short or untrimmed reads. Some of the filters also allow to redirect a read to a separate output file.
If the read has passed all the filters, it is written to the output file.
Removing adapters¶
Cutadapt supports trimming of multiple types of adapters:
Adapter type |
Command-line option |
|---|---|
|
|
|
|
|
|
|
|
|
Here is an illustration of the allowed adapter locations relative to the read and depending on the adapter type:
By default, all adapters are searched error-tolerantly. Adapter sequences may also contain the "N" wildcard character.
In addition, it is possible to remove a fixed number of bases from the beginning or end of each read, and to remove low-quality bases (quality trimming) from the 3' and 5' ends.
3' adapters¶
A 3' adapter is a piece of DNA ligated to the 3' end of the DNA fragment you are interested in. The sequencer starts the sequencing process at the 5' end of the fragment and sequences into the adapter if the read is long enough. The read that it outputs will then have a part of the adapter in the end. Or, if the adapter was short and the read length quite long, then the adapter will be somewhere within the read (followed by other bases).
For example, assume your fragment of interest is MYSEQUENCE and the adapter is ADAPTER. Depending on the read length, you will get reads that look like this:
MYSEQUEN
MYSEQUENCEADAP
MYSEQUENCEADAPTER
MYSEQUENCEADAPTERSOMETHINGELSE
Use cutadapt's -a ADAPTER option to remove this type of adapter. This will
be the result:
MYSEQUEN
MYSEQUENCE
MYSEQUENCE
MYSEQUENCE
As can be seen, cutadapt correctly deals with partial adapter matches, and also with any trailing sequences after the adapter. Cutadapt deals with 3' adapters by removing the adapter itself and any sequence that may follow. If the sequence starts with an adapter, like this:
ADAPTERSOMETHING
Then the sequence will be empty after trimming. By default, empty reads are kept and will appear in the output.
5' adapters¶
Note
Unless your adapter may also occur in a degraded form, you probably want to use an anchored 5' adapter, described in the next section.
A 5' adapter is a piece of DNA ligated to the 5' end of the DNA fragment of interest. The adapter sequence is expected to appear at the start of the read, but may be partially degraded. The sequence may also appear somewhere within the read. In all cases, the adapter itself and the sequence preceding it is removed.
Again, assume your fragment of interest is MYSEQUENCE and the adapter is ADAPTER. The reads may look like this:
ADAPTERMYSEQUENCE
DAPTERMYSEQUENCE
TERMYSEQUENCE
SOMETHINGADAPTERMYSEQUENCE
All the above sequences are trimmed to MYSEQUENCE when you use -g ADAPTER.
As with 3' adapters, the resulting read may have a length of zero when the
sequence ends with the adapter. For example, the read
SOMETHINGADAPTER
will be empty after trimming.
Anchored 5' adapters¶
In many cases, the above behavior is not really what you want for trimming 5' adapters. You may know, for example, that degradation does not occur and that the adapter is also not expected to be within the read. Thus, you always expect the read to look like the first example from above:
ADAPTERSOMETHING
If you want to trim only this type of adapter, use -g ^ADAPTER. The ^ is
supposed to indicate the the adapter is "anchored" at the beginning of the read.
In other words: The adapter is expected to be a prefix of the read. Note that
cases like these are also recognized:
ADAPTER
ADAPT
ADA
The read will simply be empty after trimming.
Be aware that cutadapt still searches for adapters error-tolerantly and, in particular, allows insertions. So if your maximum error rate is sufficiently high, even this read will be trimmed:
BADAPTERSOMETHING
The B in the beginnig is seen as an insertion. If you also want to prevent
this from happening, use the option --no-indels to disallow insertions and
deletions entirely.
Anchored 3' adapters¶
It is also possible to anchor 3' adapters to the end of the read. This is
rarely necessary, but if you have merged, for example, overlapping paired-end
reads, then it is useful. Add the $ character to the end of an
adapter sequence specified via -a in order to anchor the adapter to the
end of the read, such as -a ADAPTER$. The adapter will only be found if it
is a suffix of the read, but errors are still allowed as for 5' adapters.
You can disable insertions and deletions with --no-indels.
Anchored 3' adapters work as if you had reversed the sequence and used an appropriate anchored 5' adapter.
As an example, assume you have these reads:
MYSEQUENCEADAP
MYSEQUENCEADAPTER
MYSEQUENCEADAPTERSOMETHINGELSE
Using -a ADAPTER$ will result in:
MYSEQUENCEADAP
MYSEQUENCE
MYSEQUENCEADAPTERSOMETHINGELSE
Only the middle read is trimmed at all.
5' or 3' adapters¶
The last type of adapter is a combination of the 5' and 3' adapter. You can use it when your adapter is ligated to the 5' end for some reads and to the 3' end in other reads. This probably does not happen very often, and this adapter type was in fact originally implemented because the library preparation in an experiment did not work as it was supposed to.
For this type of adapter, the sequence is specified with -b ADAPTER (or use
the longer spelling --anywhere ADAPTER). The adapter may appear in the
beginning (even degraded), within the read, or at the end of the read (even
partially). The decision which part of the read to remove is made as follows: If
there is at least one base before the found adapter, then the adapter is
considered to be a 3' adapter and the adapter itself and everything
following it is removed. Otherwise, the adapter is considered to be a 5'
adapter and it is removed from the read, but the sequence after it remains.
Here are some examples.
Read before trimming |
Read after trimming |
Detected adapter type |
|---|---|---|
|
|
3' adapter |
|
|
3' adapter |
|
|
3' adapter |
|
|
3' adapter |
|
|
5' adapter |
|
|
5' adapter |
|
|
5' adapter |
The -b option cannot be used with colorspace data.
Error tolerance¶
All searches for adapter sequences are error tolerant. Allowed errors are
mismatches, insertions and deletions. For example, if you search for the
adapter sequence ADAPTER and the error tolerance is set appropriately
(as explained below), then also ADABTER will be found (with 1 mismatch),
as well as ADAPTR (with 1 deletion), and also ADAPPTER (with 1
insertion).
The level of error tolerance is adjusted by specifying a maximum error rate,
which is 0.1 (=10%) by default. Use the -e option to set a different value.
To determine the number of allowed errors, the maximum error rate is multiplied
by the length of the match (and then rounded off).
What does that mean?
Assume you have a long adapter LONGADAPTER and it appears in full somewhere
within the read. The length of the match is 11 characters since the full adapter
has a length of 11, therefore 11·0.1=1.1 errors are allowed with the default
maximum error rate of 0.1. This is rounded off to 1 allowed error. So the
adapter will be found within this read:
SEQUENCELONGADUPTERSOMETHING
If the match is a bit shorter, however, the result is different:
SEQUENCELONGADUPT
Only 9 characters of the adapter match: LONGADAPT matches LONGADUPT
with one substitution. Therefore, only 9·0.1=0.9 errors are allowed. Since this
is rounded off to zero allowed errors, the adapter will not be found.
The number of errors allowed for a given adapter match length is also shown in the report that cutadapt prints:
Sequence: 'LONGADAPTER'; Length: 11; Trimmed: 2 times.
No. of allowed errors:
0-9 bp: 0; 10-11 bp: 1
This tells us what we now already know: For match lengths of 0-9 bases, zero errors are allowed and for matches of length 10-11 bases, one error is allowed.
The reason for this behavior is to ensure that short matches are not favored unfairly. For example, assume the adapter has 40 bases and the maximum error rate is 0.1, which means that four errors are allowed for full-length matches. If four errors were allowed even for a short match such as one with 10 bases, this would mean that the error rate for such a case is 40%, which is clearly not what was desired.
Insertions and deletions can be disallowed by using the option
--no-indels.
See also the section on details of the alignment algorithm.
Reducing random matches¶
Since cutadapt allows partial matches between the read and the adapter sequence,
short matches can occur by chance, leading to erroneously trimmed bases. For
example, roughly 25% of all reads end with a base that is identical to the
first base of the adapter. To reduce the number of falsely trimmed bases,
the alignment algorithm requires that at least three bases match between
adapter and read. The minimum overlap length can be changed with the
--overlap``(short: ``-O) parameter. Shorter matches are simply
ignored, and the bases are not trimmed.
Requiring at least three bases to match is quite conservative. Even if no minimum overlap was required, we can compute that we lose only about 0.44 bases per read on average, see Section 2.3.3 in my thesis. With the default minimum overlap length of 3, only about 0.07 bases are lost per read.
When choosing an appropriate minimum overlap length, take into account that true adapter matches are also lost when the overlap length is higher than 1, reducing cutadapt's sensitivity.
Wildcards¶
All IUPAC nucleotide codes
(wildcard characters) are supported. For example, use an N in the adapter
sequence to match any nucleotide in the read, or use -a YACGT for an adapter
that matches both CACGT and TACGT. The wildcard character N is
useful for trimming adapters with an embedded variable barcode:
cutadapt -a ACGTAANNNNTTAGC -o output.fastq input.fastq
Wildcard characters in the adapter are enabled by default. Use the option -N
to disable this.
Matching of wildcards in the reads is also possible, but disabled by default
in order to avoid matches in reads that consist of many (often low-quality)
N bases. Use --match-read-wildcards to enable wildcards also in reads.
If wildcards are disabled entirely (that is, you use -N and do not use
--match-read-wildcards), then cutadapt compares characters by ASCII value.
Thus, both the read and adapter can be arbitrary strings (such as SEQUENCE
or ADAPTER as used here in the examples).
Wildcards do not work in colorspace.
Repeated bases in the adapter sequence¶
If you have many repeated bases in the adapter sequence, such as many N``s or
many ``A``s, you do not have to spell them out. For example, instead of writing
ten ``A in a row (AAAAAAAAAA), write A{10} instead. The number within
the curly braces specifies how often the character that preceeds it will be
repeated. This works also for IUPAC wildcard characters, as in N{5}.
It is recommended that you use quotation marks around your adapter sequence if you use this feature. For poly-A trimming, for example, you would write:
cutadapt -a "A{100}" -o output.fastq input.fastq
Modifying reads¶
This section describes in which ways reads can be modified other than adapter removal.
Removing a fixed number of bases¶
By using the --cut option or its abbreviation -u, it is possible to
unconditionally remove bases from the beginning or end of each read. If
the given length is positive, the bases are removed from the beginning
of each read. If it is negative, the bases are removed from the end.
For example, to remove the first five bases of each read:
cutadapt -u 5 -o trimmed.fastq reads.fastq
To remove the last seven bases of each read:
cutadapt -u -7 -o trimmed.fastq reads.fastq
The -u/--cut option can be combined with the other options, but
the desired bases are removed before any adapter trimming.
Quality trimming¶
The -q (or --trim-qualities) parameter can be used to trim
low-quality ends from reads before adapter removal. For this to work
correctly, the quality values must be encoded as ascii(phred quality +
33). If they are encoded as ascii(phred quality + 64), you need to add
--quality-base=64 to the command line.
Quality trimming can be done without adapter trimming, so this will work:
cutadapt -q 10 -o output.fastq input.fastq
By default, only the 3' end of each read is quality-trimmed. If you want to
trim the 5' end as well, use the -q option with two comma-separated cutoffs:
cutadapt -q 15,10 -o output.fastq input.fastq
The 5' end will then be trimmed with a cutoff of 15, and the 3' will be trimmed
with a cutoff of 10. If you only want to trim the 5' end, then use a cutoff of
0 for the 3' end, as in -q 10,0.
Quality trimming algorithm¶
The trimming algorithm is the same as the one used by BWA, but applied to both ends of the read in turn (if requested). That is: Subtract the given cutoff from all qualities; compute partial sums from all indices to the end of the sequence; cut the sequence at the index at which the sum is minimal. If both ends are to be trimmed, repeat this for the other end.
The basic idea is to remove all bases starting from the end of the read whose quality is smaller than the given threshold. This is refined a bit by allowing some good-quality bases among the bad-quality ones. In the following example, we assume that the 3' end is to be quality-trimmed.
Assume you use a threshold of 10 and have these quality values:
42, 40, 26, 27, 8, 7, 11, 4, 2, 3
Subtracting the threshold gives:
32, 30, 16, 17, -2, -3, 1, -6, -8, -7
Then sum up the numbers, starting from the end (partial sums). Stop early if the sum is greater than zero:
(70), (38), 8, -8, -25, -23, -20, -21, -15, -7
The numbers in parentheses are not computed (because 8 is greater than zero), but shown here for completeness. The position of the minimum (-25) is used as the trimming position. Therefore, the read is trimmed to the first four bases, which have quality values 42, 40, 26, 27.
Modifying read names¶
If you feel the need to modify the names of processed reads, some of the following options may be useful.
Use -y or --suffix to append a text to read names. The given string can
contain the placeholder {name}, which will be replaced with the name of the
adapter found in that read. For example, writing
cutadapt -a adapter1=ACGT -y ' we found {name}' input.fastq
changes a read named read1 to read1 we found adapter1 if the adapter
ACGT was found. The options -x/--prefix work the same, but the text
is added in front of the read name. For both options, spaces need to be
specified explicitly, as in the above example. If no adapter was found in a
read, the text no_adapter is inserted for {name}.
In order to remove a suffix of each read name, use --strip-suffix.
Some old 454 read files contain the length of the read in the name:
>read1 length=17
ACGTACGTACAAAAAAA
If you want to update this to the correct length after trimming, use the option
--length-tag. In this example, this would be --length-tag 'length='.
After trimming, the read would perhaps look like this:
>read1 length=10
ACGTACGTAC
Read modification order¶
The read modifications described above are applied in the following order to each read. Steps not requested on the command-line are skipped.
Unconditional base removal with
--cutQuality trimming (
-q)Adapter trimming (
-a,-b,-gand uppercase versions)N-end trimming (
--trim-n)Length tag modification (
--length-tag)Read name suffixe removal (
--strip-suffix)Addition of prefix and suffix to read name (
-x/--prefixand-y/--suffix)Double-encode the sequence (only colorspace)
Replace negative quality values with zero (zero capping, only colorspace)
Trim primer base (only colorspace)
The last three steps are colorspace-specific.
Filtering reads¶
By default, all processed reads, no matter whether they were trimmed are not,
are written to the output file specified by the -o option (or to standard
output if -o was not provided). For paired-end reads, the second read in a
pair is always written to the file specified by the -p option.
The options described here make it possible to filter reads by either discarding them entirely or by redirecting them to other files. When redirecting reads, the basic rule is that each read is written to at most one file. You cannot write reads to more than one output file.
In the following, the term "processed read" refers to a read to which all modifications have been applied (adapter removal, quality trimming etc.). A processed read can be identical to the input read if no modifications were done.
--minimum-length Nor-m NThrow away processed reads shorter than N bases.
--too-short-output FILEInstead of throwing away the reads that are too short according to
-m, write them to FILE (in FASTA/FASTQ format).--maximum-length Nor-M NThrow away processed reads longer than N bases.
--too-long-output FILEInstead of throwing away the reads that are too long (according to
-M), write them to FILE (in FASTA/FASTQ format).--untrimmed-output FILEWrite all reads without adapters to FILE (in FASTA/FASTQ format) instead of writing them to the regular output file.
--discard-trimmedThrow away reads in which an adapter was found.
--discard-untrimmedThrow away reads in which no adapter was found. This has the same effect as specifying
--untrimmed-output /dev/null.
The options --too-short-output and --too-long-output are applied first.
This means, for example, that a read that is too long will never end up in the
--untrimmed-output file when --too-long-output was given, no matter
whether it was trimmed or not.
The options --untrimmed-output, --discard-trimmed and -discard-untrimmed
are mutually exclusive.
Trimming paired-end reads¶
Cutadapt supports trimming of paired-end reads, trimming both reads in a pair at the same time.
Assume the input is in reads.1.fastq and reads.2.fastq and that
ADAPTER_FWD should be trimmed from the forward reads (first file)
and ADAPTER_REV from the reverse reads (second file).
The basic command-line is:
cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq
-p is the short form of --paired-output. The option -A is used here
to specify an adapter sequence that cutadapt
should remove from the second read in each pair. There are also the options
-G, -B. All of them work just like their lowercase counterparts,
except that the adapter is searched for in the second read in each paired-end
read. There is also option -U, which you can use to remove a fixed number
of bases from the second read in a pair.
While it is possible to run cutadapt on the two files separately, processing both files at the same time is highly recommended since the program can check for problems in your input files only when they are processed together.
When you use -p/--paired-output, cutadapt checks whether the files are
properly paired. An error is raised if one of the files contains more reads than
the other or if the read names in the two files do not match. Only the part of
the read name before the first space is considered. If the read name ends with
/1 or /2, then that is also ignored. For example, two FASTQ headers that
would be considered to denote properly paired reads are:
@my_read/1 a comment
and:
@my_read/2 another comment
As soon as you start to use one of the filtering options that discard reads, it is mandatory you process both files at the same time to make sure that the output files are kept synchronized: If a read is removed from one of the files, cutadapt will ensure it is also removed from the other file.
The following command-line options are applied to both reads:
-q(along with--quality-base)--timesapplies to all the adapters given--no-trim--trim-n--mask--length-tag--prefix,--suffix--strip-f3--colorspace,--bwa,-z,--no-zero-cap,--double-encode,--trim-primer
The following limitations still exist:
The
--info-file,--rest-fileand--wildcard-fileoptions write out information only from the first read.Demultiplexing is not yet supported with paired-end data.
Filtering paired-end reads¶
The filtering options listed above can also be used when trimming paired-end data. Since there are two reads, however, the filtering criteria are checked for both reads. The question is what to do when a criterion applies to only one read and not the other.
By default, the filtering options discard or redirect the read pair if any
of the two reads fulfill the criteria. That is, --max-n discards the pair
if one of the two reads has too many N bases; --discard-untrimmed
discards the pair if one of the reads does not contain an adapter;
--minimum-length discards the pair if one of the reads is too short;
and --maximum-length discards the pair if one of the reads is too long.
Note that the --discard-trimmed filter would also apply because it is also
the case that at least one of the reads is trimmed!
To require that filtering criteria must apply to both reads in order for a
read pair to be considered "filtered", use the option --pair-filter=both.
To further complicate matters, cutadapt switches to a backwards compatibility
mode ("legacy mode") when none of the uppercase modification options
(-A/-B/-G/-U) are given. In that mode, filtering criteria are
checked only for the first read. Cutadapt will also tell you at the top of
the report whether legacy mode is active. Check that line if you get strange
results!
These are the paired-end specific filtering and output options:
--paired-output FILEor-p FILEWrite the second read of each processed pair to FILE (in FASTA/FASTQ format).
--untrimmed-paired-output FILEUsed together with
--untrimmed-output. The second read in a pair is written to this file when the processed pair was not trimmed.--pair-filter=(any|both)Which of the reads in a paired-end read have to match the filtering criterion in order for it to be filtered.
Note that the option names can be abbreviated as long as it is clear which
option is meant (unique prefix). For example, instead of --untrimmed-output
and --untrimmed-paired-output, you can write --untrimmed-o and
--untrimmed-p.
Interleaved paired-end reads¶
Paired-end reads can be read from a single FASTQ file in which the entries for
the first and second read from each pair alternate. The first read in each pair
comes before the second. Enable this file format by adding the --interleaved
option to the command-line. For example:
cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.fastq reads.fastq
The output FASTQ file will also be written interleaved. Cutadapt will detect if the input file is not properly interleaved by checking whether read names match and whether the file contains an even number of entries.
When --interleaved is used, legacy mode is disabled (that is,
read-modification options such as -q always apply to both reads).
Legacy paired-end read trimming¶
Note
This section describes the way paired-end trimming was done
in cutadapt before 1.8, where the -A, -G, -B options were not
available. It is less safe and more complicated, but you can still use it.
If you do not use any of the filtering options that discard reads, such
as --discard, --minimum-length or --maximum-length, you can run
cutadapt on each file separately:
cutadapt -a ADAPTER_FWD -o trimmed.1.fastq reads1.fastq
cutadapt -a ADAPTER_REV -o trimmed.2.fastq reads2.fastq
You can use the options that are listed under 'Additional modifications' in cutadapt's help output without problems. For example, if you want to quality-trim the first read in each pair with a threshold of 10, and the second read in each pair with a threshold of 15, then the commands could be:
cutadapt -q 10 -a ADAPTER_FWD -o trimmed.1.fastq reads1.fastq
cutadapt -q 15 -a ADAPTER_REV -o trimmed.2.fastq reads2.fastq
If you use any of the filtering options, you must use cutadapt in the following
way (with the -p option) to make sure that read pairs remain sychronized.
First trim the forward read, writing output to temporary files (we also add some quality trimming):
cutadapt -q 10 -a ADAPTER_FWD --minimum-length 20 -o tmp.1.fastq -p tmp.2.fastq reads.1.fastq reads.2.fastq
Then trim the reverse read, using the temporary files as input:
cutadapt -q 15 -a ADAPTER_REV --minimum-length 20 -o trimmed.2.fastq -p trimmed.1.fastq tmp.2.fastq tmp.1.fastq
Finally, remove the temporary files:
rm tmp.1.fastq tmp.2.fastq
Please see the previous section for a much simpler way of trimming paired-end reads!
In legacy paired-end mode, the read-modifying options such as -q only
apply to the first file in each call to cutadapt (first reads.1.fastq, then
tmp.2.fastq in this example). Reads in the second file are not affected by those
options, but by the filtering options: If a read in the first file is
discarded, then the matching read in the second file is also filtered
and not written to the output given by --paired-output in order to
keep both output files synchronized.
Multiple adapters¶
It is possible to specify more than one adapter sequence by using the options
-a, -b and -g more than once. Any combination is allowed, such as
five -a adapters and two -g adapters. Each read will be searched for
all given adapters, but only the best matching adapter is removed. (But it
is possible to trim more than one adapter from each
read). This is how a command may look like to trim one of two
possible 3' adapters:
cutadapt -a TGAGACACGCA -a AGGCACACAGGG -o output.fastq input.fastq
The adapter sequences can also be read from a FASTA file. Instead of giving an
explicit adapter sequence, you need to write file: followed by the name of
the FASTA file:
cutadapt -a file:adapters.fasta -o output.fastq input.fastq
All of the sequences in the file adapters.fasta will be used as 3'
adapters. The other adapter options -b and -g also support this. Again,
only the best matching adapter is trimmed from each read.
When cutadapt has multiple adapter sequences to work with, either specified explicitly on the command line or via a FASTA file, it decides in the following way which adapter should be trimmed:
All given adapter sequences are matched to the read.
Adapter matches where the overlap length (see the
-Oparameter) is too small or where the error rate is too high (-e) are removed from further consideration.Among the remaining matches, the one with the greatest number of matching bases is chosen.
If there is a tie, the first adapter wins. The order of adapters is the order in which they are given on the command line or in which they are found in the FASTA file.
If your adapter sequences are all similar and differ only by a variable barcode sequence, you should use a single adapter sequence instead that contains wildcard characters.
Named adapters¶
Cutadapt reports statistics for each adapter separately. To identify the adapters, they are numbered and the adapter sequence is also printed:
=== Adapter 1 ===
Sequence: AACCGGTT; Length 8; Trimmed: 5 times.
If you want this to look a bit nicer, you can give each adapter a name in this way:
cutadapt -a My_Adapter=AACCGGTT -o output.fastq input.fastq
The actual adapter sequence in this example is AACCGGTT and the name
assigned to it is My_Adapter. The report will then contain this name in
addition to the other information:
=== Adapter 'My_Adapter' ===
Sequence: TTAGACATATCTCCGTCG; Length 18; Trimmed: 5 times.
When adapters are read from a FASTA file, the sequence header is used as the adapter name.
Adapter names are also used in column 8 of info files.
Demultiplexing¶
Cutadapt supports demultiplexing, which means that reads are written to different
output files depending on which adapter was found in them. To use this, include
the string {name} in the name of the output file and give each adapter a name.
The path is then interpreted as a template and each trimmed read is written
to the path in which {name} is replaced with the name of the adapter that
was found in the read. Reads in which no adapter was found will be written to a
file in which {name} is replaced with unknown.
Example:
cutadapt -a one=TATA -a two=GCGC -o trimmed-{name}.fastq.gz input.fastq.gz
This command will create the three files demulti-one.fastq.gz,
demulti-two.fastq.gz and demulti-unknown.fastq.gz. You can also
provide adapter sequences in a FASTA file.
In order to not trim the input files at all, but to only do multiplexing, use
option --no-trim. And if you want to output the reads in which no
adapters were found to a different file, use the --untrimmed-output
parameter with a file name. Here is an example that uses both parameters and
reads the adapters from a FASTA file (note that --untrimmed-output can be
abbreviated):
cutadapt -a file:barcodes.fasta --no-trim --untrimmed-o untrimmed.fastq.gz -o trimmed-{name}.fastq.gz input.fastq.gz
Trimming more than one adapter from each read¶
By default, at most one adapter sequence is removed from each read, even if
multiple adapter sequences were provided. This can be changed by using the
--times option (or its abbreviated form -n). Cutadapt will then search
for all the given adapter sequences repeatedly, either until no adapter match
was found or until the specified number of rounds was reached.
As an example, assume you have a protocol in which a 5' adapter gets ligated to your DNA fragment, but it's possible that the adapter is ligated more than once. So your sequence could look like this:
ADAPTERADAPTERADAPTERMYSEQUENCE
To be on the safe side, you assume that there are at most 5 copies of the adapter sequence. This command can be used to trim the reads correctly:
cutadapt -g ^ADAPTER -n 5 -o output.fastq input.fastq
This feature can also be used to search for 5'/3' linked adapters. For example, when the 5' adapter is FIRST and the 3' adapter is SECOND, then the read could look like this:
FIRSTMYSEQUENCESECOND
That is, the sequence of interest is framed by the 5' and the 3' adapter. The following command can be used to trim such a read:
cutadapt -g ^FIRST -a SECOND -n 2 ...
Support for linked adapters is currently incomplete. For example, it is not possible to specify that SECOND should only be trimmed when FIRST also occurs. See also this feature request, and comment on it if you would like to see this implemented.
Illumina TruSeq¶
If you have reads containing Illumina TruSeq adapters, follow these steps.
Single-end reads as well as the first reads of paired-end data need to be
trimmed with A + the “TruSeq Indexed Adapter”. Use only the prefix of the
adapter sequence that is common to all Indexed Adapter sequences:
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o trimmed.fastq.gz reads.fastq.gz
If you have paired-end data, trim also read 2 with the reverse complement of the “TruSeq Universal Adapter”. The full command-line looks as follows:
cutadapt \
-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \
-o trimmed.1.fastq.gz -p trimmed.2.fastq.gz \
reads.1.fastq.gz reads.2.fastq.gz
See also the section about paired-end adapter trimming above.
If you want to simplify this a bit, you can also use the common prefix
AGATCGGAAGAGC as the adapter sequence in both cases:
cutadapt \
-a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed.1.fastq.gz -p trimmed.2.fastq.gz \
reads.1.fastq.gz reads.2.fastq.gz
The adapter sequences can be found in the document Illumina TruSeq Adapters De-Mystified.
Warning about incomplete adapter sequences¶
Sometimes cutadapt’s report ends with these lines:
WARNING:
One or more of your adapter sequences may be incomplete.
Please see the detailed output above.
Further up, you’ll see a message like this:
Bases preceding removed adapters:
A: 95.5%
C: 1.0%
G: 1.6%
T: 1.6%
none/other: 0.3%
WARNING:
The adapter is preceded by "A" extremely often.
The provided adapter sequence may be incomplete.
To fix the problem, add "A" to the beginning of the adapter sequence.
This means that in 95.5% of the cases in which an adapter was removed from a
read, the base coming before that was an A. If your DNA fragments are
not random, such as in amplicon sequencing, then this is to be expected and
the warning can be ignored. If the DNA fragments are supposed to be random,
then the message may be genuine: The adapter sequence may be incomplete and
should include an additional A in the beginning.
This warning exists because some documents list the Illumina TruSeq adapters
as starting with GATCGGA.... While that is technically correct, the
library preparation actually results in an additional A before that
sequence, which also needs to be removed. See the previous
section for the correct sequence.
Dealing with N bases¶
Cutadapt supports the following options to deal with N bases in your reads:
--max-n COUNTDiscard reads containing more than COUNT
Nbases. A fractional COUNT between 0 and 1 can also be given and will be treated as the proportion of maximally allowedNbases in the read.--trim-nRemove flanking
Nbases from each read. That is, a read such as this:NNACGTACGTNNNNIs trimmed to just
ACGTACGT. This option is applied after adapter trimming. If you want to get rid ofNbases before adapter removal, use quality trimming:Nbases typically also have a low quality value associated with them.
Bisulfite sequencing (RRBS)¶
When trimming reads that come from a library prepared with the RRBS (reduced
representation bisulfit sequencing) protocol, the last two 3' bases must be
removed in addition to the adapter itself. This can be achieved by using not
the adapter sequence itself, but by adding two wildcard characters to its
beginning. If the adapter sequence is ADAPTER, the command for trimming
should be:
cutadapt -a NNADAPTER -o output.fastq input.fastq
Details can be found in Babraham bioinformatics' "Brief guide to RRBS". A summary follows.
During RRBS library preparation, DNA is digested with the restriction enzyme
MspI, generating a two-base overhang on the 5' end (CG). MspI recognizes
the sequence CCGG and cuts
between C and CGG. A double-stranded DNA fragment is cut in this way:
5'-NNNC|CGGNNN-3'
3'-NNNGGC|CNNN-5'
The fragment between two MspI restriction sites looks like this:
5'-CGGNNN...NNNC-3'
3'-CNNN...NNNGGC-5'
Before sequencing (or PCR) adapters can be ligated, the missing base positions must be filled in with GTP and CTP:
5'-ADAPTER-CGGNNN...NNNCcg-ADAPTER-3'
3'-ADAPTER-gcCNNN...NNNGGC-ADAPTER-5'
The filled-in bases, marked in lowercase above, do not contain any original
methylation information, and must therefore not be used for methylation calling.
By prefixing the adapter sequence with NN, the bases will be automatically
stripped during adapter trimming.
Cutadapt's output¶
How to read the report¶
After every run, cutadapt prints out per-adapter statistics. The output starts with something like this:
Sequence: 'ACGTACGTACGTTAGCTAGC'; Length: 20; Trimmed: 2402 times.
The meaning of this should be obvious.
The next piece of information is this:
No. of allowed errors:
0-9 bp: 0; 10-19 bp: 1; 20 bp: 2
The adapter has, as was shown above, has a length of 20 characters. We are using the default error rate of 0.1. What this implies is shown above: Matches up to a length of 9 bp are allowed to have no errors. Matches of lengths 10-19 bp are allowd to have 1 error and matches of length 20 can have 2 errors. See also the section about error-tolerant matching.
Finally, a table is output that gives more detailed information about the lengths of the removed sequences. The following is only an excerpt; some rows are left out:
Overview of removed sequences
length count expect max.err error counts
3 140 156.2 0 140
4 57 39.1 0 57
5 50 9.8 0 50
6 35 2.4 0 35
...
100 397 0.0 3 358 36 3
The first row tells us the following: Three bases were removed in 140 reads; randomly, one would expect this to occur 156.2 times; the maximum number of errors at that match length is 0 (this is actually redundant since we know already that no errors are allowed at lengths 0-9 bp).
The last column shows the number of reads that had 0, 1, 2 ... errors. In the last row, for example, 358 reads matched the adapter with zero errors, 36 with 1 error, and 3 matched with 2 errors.
The "expect" column gives only a rough estimate of the number of sequences that is expected to match randomly (it assumes a GC content of 50%, for example), but it can help to estimate whether the matches that were found are true adapter matches or if they are due to chance. At lengths 6, for example, only 2.4 reads are expected, but 35 do match, which hints that most of these matches are due to actual adapters.
Note that the "length" column refers to the length of the removed sequence. That is, the actual length of the match in the above row at length 100 is 20 since that is the adapter length. Assuming the read length is 100, the adapter was found in the beginning of 397 reads and therefore those reads were trimmed to a length of zero.
The table may also be useful in case the given adapter sequence contains an error. In that case, it may look like this:
...
length count expect max.err error counts
10 53 0.0 1 51 2
11 45 0.0 1 42 3
12 51 0.0 1 48 3
13 39 0.0 1 0 39
14 40 0.0 1 0 40
15 36 0.0 1 0 36
...
We can see that no matches longer than 12 have zero errors. In this case, it indicates that the 13th base of the given adapter sequence is incorrect.
Format of the info file¶
When the --info-file command-line parameter is given, detailed
information about the found adapters is written to the given file. The
output is a tab-separated text file. Each line corresponds to one read
of the input file (unless --times is used, see below). The fields are:
Read name
Number of errors
0-based start coordinate of the adapter match
0-based end coordinate of the adapter match
Sequence of the read to the left of the adapter match (can be empty)
Sequence of the read that was matched to the adapter
Sequence of the read to the right of the adapter match (can be empty)
Name of the found adapter.
Quality values corresponding to sequence left of the adapter match (can be empty)
Quality values corresponding to sequence matched to the adapter (can be empty)
Quality values corresponding to sequence to the right of the adapter match (can be empty)
The concatenation of the fields 5-7 yields the full read sequence. Column 8 identifies the found adapter. The section about named adapters <named-adapters> describes how to give a name to an adapter. Adapters without a name are numbered starting from 1. Fields 9-11 are empty if quality values are not available. Concatenating them yields the full sequence of quality values.
If no adapter was found, the format is as follows:
Read name
The value -1
The read sequence
Quality values
When parsing the file, be aware that additional columns may be added in the future. Note also that some fields can be empty, resulting in consecutive tabs within a line.
If the --times option is used and greater than 1, each read can appear
more than once in the info file. There will be one line for each found adapter,
all with identical read names. Only for the first of those lines will the
concatenation of columns 5-7 be identical to the original read sequence (and
accordingly for columns 9-11). For subsequent lines, the shown sequence are the
ones that were used in subsequent rounds of adapter trimming, that is, they get
successively shorter.
Columns 9-11 have been added in cutadapt version 1.9.
The alignment algorithm¶
Since the publication of the EMBnet journal application note about cutadapt, the alignment algorithm used for finding adapters has changed significantly. An overview of this new algorithm is given in this section. An even more detailed description is available in Chapter 2 of my PhD thesis Algorithms and tools for the analysis of high-throughput DNA sequencing data.
The algorithm is based on semiglobal alignment, also called free-shift, ends-free or overlap alignment. In a regular (global) alignment, the two sequences are compared from end to end and all differences occuring over that length are counted. In semiglobal alignment, the sequences are allowed to freely shift relative to each other and differences are only penalized in the overlapping region between them:
FANTASTIC
ELEFANT
The prefix ELE and the suffix ASTIC do not have a counterpart in the
respective other row, but this is not counted as an error. The overlap FANT
has a length of four characters.
Traditionally, alignment scores are used to find an optimal overlap aligment: This means that the scoring function assigns a positive value to matches, while mismatches, insertions and deletions get negative values. The optimal alignment is then the one that has the maximal total score. Usage of scores has the disadvantage that they are not at all intuitive: What does a total score of x mean? Is that good or bad? How should a threshold be chosen in order to avoid finding alignments with too many errors?
For cutadapt, the adapter alignment algorithm uses unit costs instead. This means that mismatches, insertions and deletions are counted as one error, which is easier to understand and allows to specify a single parameter for the algorithm (the maximum error rate) in order to describe how many errors are acceptable.
There is a problem with this: When using costs instead of scores, we would like to minimize the total costs in order to find an optimal alignment. But then the best alignment would always be the one in which the two sequences do not overlap at all! This would be correct, but meaningless for the purpose of finding an adapter sequence.
The optimization criteria are therefore a bit different. The basic idea is to consider the alignment optimal that maximizes the overlap between the two sequences, as long as the allowed error rate is not exceeded.
Conceptually, the procedure is as follows:
Consider all possible overlaps between the two sequences and compute an alignment for each, minimizing the total number of errors in each one.
Keep only those alignments that do not exceed the specified maximum error rate.
Then, keep only those alignments that have a maximal number of matches (that is, there is no alignment with more matches).
If there are multiple alignments with the same number of matches, then keep only those that have the smallest error rate.
If there are still multiple candidates left, choose the alignment that starts at the leftmost position within the read.
In Step 1, the different adapter types are taken into account: Only those overlaps that are actually allowed by the adapter type are actually considered.