Recipes

For some trimming applications, the pre-defined adapter types behave differently from what you would like to have. In this section, we show some ways in which cutadapt can be made to behave in the desired way.

Note

This section is still being written.

Forcing matches to be at the end of the read

Use -a TACGGCATXXX. The X is always counted as a mismatch and will force the adapter match to be at the end. This is not the same as an anchored 3' adapter since partial matches are still allowed.

Removing more than one adapter

If you want to remove more than one adapter, let's say a 5' adapter and a 3' adapter, you have two options.

First, you can specify both adapters and also --times=2 (or the short version -n 2). For example:

cutadapt -g ^TTAAGGCC -a TACGGACT -n 2 -o output.fastq input.fastq

This instructs cutadapt to run two rounds of adapter finding and removal. That means that, after the first round and only when an adapter was actually found, another round is performed. In both rounds, all given adapters (two in this case) are searched and removed. The problem is that it could happen that one adapter is found twice (so the 3' adapter, for example, could be removed twice).

The second option is to not use the -n option, but to run cutadapt twice, first removing one adapter and then the other. It is easiest if you use a pipe as in this example:

cutadapt -g ^TTAAGGCC input.fastq | cutadapt -a TACGGACT - > output.fastq

Trimming poly-A tails

If you want to trim a poly-A tail from the 3' end of your reads, use the 3' adapter type (-a) with an adapter sequence of many repeated A nucleotides. Starting with version 1.8 of cutadapt, you can use the following notation to specify a sequence that consists of 100 A:

cutadapt -a "A{100}" -o output.fastq input.fastq

This also works when there are sequencing errors in the poly-A tail. So this read

TACGTACGTACGTACGAAATAAAAAAAAAAA

will be trimmed to:

TACGTACGTACGTACG

If for some reason you would like to use a shorter sequence of A, you can do so: The matching algorithm always picks the leftmost match that it can find, so cutadapt will do the right thing even when the tail has more A than you used in the adapter sequence. However, sequencing errors may result in shorter matches than desired. For example, using -a "A{10}", the read above (where the AAAT is followed by eleven A) would be trimmed to:

TACGTACGTACGTACGAAAT

Depending on your application, perhaps a variant of -a A{10}N{90} is an alternative, forcing the match to be located as much to the left as possible, while still allowing for non-A bases towards the end of the read.

Other things (unfinished)

  • How to detect adapters

  • Use cutadapt for quality-trimming only

  • Use it for minimum/maximum length filtering

  • Use it for conversion to FASTQ