# Copyright (c) 2004  by  Mihaela Pertea.

Train GlimmerHMM module.

To use this trainning module, first run make in this directory, and than call
trainGlimmerHMM with the parameters specified below.

  Usage:
    trainGlimmerHMM <mfasta_file> <exon_file> [optional_parameters]

    <mfasta_file> is a multifasta file containing the sequences for training
                  with the usual format:

                  >seq1
                  AGTCGTCGCTAGCTAGCTAGCATCGAGTCTTTTCGATCGAGGACTAGACTT
                  CTAGCTAGCTAGCATAGCATACGAGCATATCGGTCATGAGACTGATTGGGC
                  >seq2
                  TTTAGCTAGCTAGCATAGCATACGAGCATATCGGTAGACTGATTGGGTTTA
                  TGCGTTA

    <exon_file>  is a file with the exon coordinates relative to the sequences
                 contained in the <mfasta_file>; different genes are separated
                 by a blank line; I am assuming a format like below:

                 seq1 5 15
                 seq1 20 34

                 seq1 50 48
                 seq1 45 36

                 seq2 17 20

                 In this example seq1 has two genes: one on the direct strand 
                 and another one on the complementary strand

    [optional_parameters]

     -i i1,i2,...,in 
                isochores to be considered (e.g. if two isochores are desired 
		between 0-40% GC content and 40-100% then the option should 
		be: -i 0,40,100; 
		default	is -i 0,100 )
    -f val     	val = average value of upstream UTR region if known
    -l val     	val = average value of downstream UTR region if known                
    -n val     	val = average value of intergenic region if known

After running trainGlimmerHMM, a directory will be created in the directory 
where you ran the traininning procedure from. This directory will be called
TrainGlimmM[data][time] where [data] and [time] specify the data and the 
time when the directory was created. This directory contains the training 
parameters needed by GlimmerHMM to run. A log file named after the name of 
the diretory will be also created specifying some of the default 
parameters set for GlimmerHMM.